Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4149766
End position: 4149813
Length: 48

DNA sequence
>NC_010634, from 4149766 to 4149813 (48 bp); Yersinia pseudotuberculosis PB1/+ GATTTATTCATCAAACAATGCATTCATCAAACAATGCATTCATCAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4149809-4150090	Sequence	YPTS_3729 - barnase inhibitor (Protein is coded in complementary strand; from 4150090 to 4149809)