Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4012983
End position: 4013015
Length: 33

DNA sequence
>NC_010634, from 4012983 to 4013015 (33 bp); Yersinia pseudotuberculosis PB1/+ GAACAAAGAAAGGACAAAGAAAGGACAAAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4012848-4013957	Sequence	YPTS_3614 - Na+/H+ antiporter family protein (Protein is coded in complementary strand; from 4013957 to 4012848)