Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3884172
End position: 3884225
Length: 54

DNA sequence
>NC_010634, from 3884172 to 3884225 (54 bp); Yersinia pseudotuberculosis PB1/+ ACTTTATTTGTGGTGACGACATTATTTGTGGTGACGACATCATTTGGGGTGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3884018-3884464	Sequence	YPTS_3476 flgB flagellar basal body rod protein FlgB (Protein is coded in complementary strand; from 3884464 to 3884018)