Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3807422
End position: 3807448
Length: 27

DNA sequence
>NC_010634, from 3807422 to 3807448 (27 bp); Yersinia pseudotuberculosis PB1/+ ACTCCTTGCATTCCTTGCATTCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3807406-3808179	Sequence	YPTS_3431 - thioesterase (Protein is coded in complementary strand; from 3808179 to 3807406)