Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3731325
End position: 3731360
Length: 36

DNA sequence
>NC_010634, from 3731325 to 3731360 (36 bp); Yersinia pseudotuberculosis PB1/+ TCACTTTCCTCACTTTCCTCACTTTCCTCACTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3731058-3731567	Sequence	YPTS_3377 - hypothetical protein (Protein is coded in complementary strand; from 3731567 to 3731058)