Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3660876
End position: 3660943
Length: 68

DNA sequence
>NC_010634, from 3660876 to 3660943 (68 bp); Yersinia pseudotuberculosis PB1/+ TGCCATCAGTGTTTCAATACCATCAGTGATTCAATACCATCAATGCTTCAATGCCATCAATGCTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3660916-3662229	Sequence	YPTS_3317 - proline aminopeptidase P II (Protein is coded in complementary strand; from 3662229 to 3660916)