Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3646768
End position: 3646818
Length: 51

DNA sequence
>NC_010634, from 3646768 to 3646818 (51 bp); Yersinia pseudotuberculosis PB1/+ AAATATGTGTCTGTATTAAATATGTGTCTGTATTAAACATGTGTCTGTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3646818-3647519	Sequence	YPTS_3307 - hemolysin III family channel protein (Protein is coded in complementary strand; from 3647519 to 3646818)