Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3632889
End position: 3632912
Length: 24

DNA sequence
>NC_010634, from 3632889 to 3632912 (24 bp); Yersinia pseudotuberculosis PB1/+ GGCTTTGTCTTTGGGTTTGGCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3631726-3632940	Sequence	YPTS_3293 - integrase family protein (Protein is coded in complementary strand; from 3632940 to 3631726)