Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3391446
End position: 3391496
Length: 51

DNA sequence
>NC_010634, from 3391446 to 3391496 (51 bp); Yersinia pseudotuberculosis PB1/+ TCTTTTTAGTATTAACCTATTTTTAGCATCAACCTGTTTTTACCATTAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3391492-3392157	Sequence	YPTS_3062 - ABC transporter-like protein (Protein is coded in complementary strand; from 3392157 to 3391492)