Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3315776
End position: 3315820
Length: 45

DNA sequence
>NC_010634, from 3315776 to 3315820 (45 bp); Yersinia pseudotuberculosis PB1/+ GTTGGTTTGGTGTCTGTTGGTTTGGTGTCTGTTGGTTTGGTGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3315563-3316645	Sequence	YPTS_2985 - hypothetical protein (Protein is coded in complementary strand; from 3316645 to 3315563)