Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3239973
End position: 3240014
Length: 42

DNA sequence
>NC_010634, from 3239973 to 3240014 (42 bp); Yersinia pseudotuberculosis PB1/+ AGAGTGAAGTTTGAAGTTTGAAGTTTGAAGTTTGAAGTTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3238889-3239974	Sequence	YPTS_2918 - spermidine/putrescine ABC transporter ATPase