Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3222358
End position: 3222402
Length: 45

DNA sequence
>NC_010634, from 3222358 to 3222402 (45 bp); Yersinia pseudotuberculosis PB1/+ GTTTATAAGGCCCGTGTTTATAAGACCCGAGTTTATAAGACGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3220712-3222424	Sequence	YPTS_2905 - phosphate ABC transporter permease (Protein is coded in complementary strand; from 3222424 to 3220712)