Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3051548
End position: 3051595
Length: 48

DNA sequence
>NC_010634, from 3051548 to 3051595 (48 bp); Yersinia pseudotuberculosis PB1/+ TTATCAAACACAATCTATTTCAAACACAATCTATCTCAAATACAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3051568-3052374	Sequence	YPTS_2753 - virulence protein SciE type (Protein is coded in complementary strand; from 3052374 to 3051568)