Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3043350
End position: 3043409
Length: 60

DNA sequence
>NC_010634, from 3043350 to 3043409 (60 bp); Yersinia pseudotuberculosis PB1/+ GTGCTGCTTGTTGTAACGGTGCTTGTTGTAATGGTGCTTGATGTAATGGTGCTTGATGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3043313-3043663	Sequence	YPTS_2743 - heme exporter protein CcmD (Protein is coded in complementary strand; from 3043663 to 3043313)