Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 3031653
End position: 3031697
Length: 45

DNA sequence
>NC_010634, from 3031653 to 3031697 (45 bp); Yersinia pseudotuberculosis PB1/+ CACAAAACAGGTCAACACAAAACAGGTCAACACAAAACAGGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3031588-3031749	Sequence	YPTS_2732 - hypothetical protein (Protein is coded in complementary strand; from 3031749 to 3031588)