Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2952441
End position: 2952485
Length: 45

DNA sequence
>NC_010634, from 2952441 to 2952485 (45 bp); Yersinia pseudotuberculosis PB1/+ GCTGCTGTTGATATGGTTACTGCTGATATGGTTACTGTTGATATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2951452-2953368	Sequence	YPTS_2660 - phosphogluconate dehydratase (Protein is coded in complementary strand; from 2953368 to 2951452)