Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2631440
End position: 2631481
Length: 42

DNA sequence
>NC_010634, from 2631440 to 2631481 (42 bp); Yersinia pseudotuberculosis PB1/+ ATGGTTGGCTATCAATTGTTTGCTATCAATTGCTGGCTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2631452-2632384	Sequence	YPTS_2375 - putative DNA-binding transcriptional regulator (Protein is coded in complementary strand; from 2632384 to 2631452)