Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2624244
End position: 2624267
Length: 24

DNA sequence
>NC_010634, from 2624244 to 2624267 (24 bp); Yersinia pseudotuberculosis PB1/+ GTAGGTATAGGTGTGGGTGTAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2622535-2625483	Sequence	YPTS_2367 - YD repeat-containing protein (Protein is coded in complementary strand; from 2625483 to 2622535)