Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 251720
End position: 251767
Length: 48

DNA sequence
>NC_010634, from 251720 to 251767 (48 bp); Yersinia pseudotuberculosis PB1/+ GATTTAATCAAACATTAACCTAATCAAACATTGACCTAATCAAACATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 251760-254126	Sequence	YPTS_0230 zntA zinc/cadmium/mercury/lead-transporting ATPase (Protein is coded in complementary strand; from 254126 to 251760)