Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2380067
End position: 2380126
Length: 60

DNA sequence
>NC_010634, from 2380067 to 2380126 (60 bp); Yersinia pseudotuberculosis PB1/+ GATTGTAGTGTGATGGATTGTAGTGTGATGGATTGTAGTGTGATGGATTGTAGTGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2379034-2380080	Sequence	YPTS_2153 - selenophosphate synthetase
ORF... 2380095-2380187	Sequence	YPTS_2154 - hypothetical protein