Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2349813
End position: 2349860
Length: 48

DNA sequence
>NC_010634, from 2349813 to 2349860 (48 bp); Yersinia pseudotuberculosis PB1/+ TTCATTGTTATGATGATGGATTGTTATAATGATAGATTGCTATGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2349853-2351025	Sequence	YPTS_2127 - major facilitator transporter (Protein is coded in complementary strand; from 2351025 to 2349853)