Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2240889
End position: 2240912
Length: 24

DNA sequence
>NC_010634, from 2240889 to 2240912 (24 bp); Yersinia pseudotuberculosis PB1/+ GTGTAGGTGTAGGTGTAGGTGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2238990-2240981	Sequence	YPTS_2025 - chorismate binding-like protein (Protein is coded in complementary strand; from 2240981 to 2238990)