Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2186381
End position: 2186434
Length: 54

DNA sequence
>NC_010634, from 2186381 to 2186434 (54 bp); Yersinia pseudotuberculosis PB1/+ CACTGCCACTAAATAATTCACTGCCGCTACATCATTCACTACCACTACATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2185493-2186455	Sequence	YPTS_1981 - LysR family transcriptional regulator