Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2172964
End position: 2173017
Length: 54

DNA sequence
>NC_010634, from 2172964 to 2173017 (54 bp); Yersinia pseudotuberculosis PB1/+ TTCCACAGTATCCGCAGTTTCCGCAGTATCTACAGTTTCCGCAGTATCTACAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2172650-2176678	Sequence	YPTS_1971 - histidine kinase (Protein is coded in complementary strand; from 2176678 to 2172650)