Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2053151
End position: 2053195
Length: 45

DNA sequence
>NC_010634, from 2053151 to 2053195 (45 bp); Yersinia pseudotuberculosis PB1/+ GTTGTTGTTGAGGCCAATGCTGTTGAGGCCAATGTTGTCGAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2052677-2053228	Sequence	YPTS_1823 - flagellar biosynthesis protein FliO (Protein is coded in complementary strand; from 2053228 to 2052677)