Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1696339
End position: 1696380
Length: 42

DNA sequence
>NC_010634, from 1696339 to 1696380 (42 bp); Yersinia pseudotuberculosis PB1/+ CCATAAACATGCGTCCATAAACATGCGTCCATAAACATGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1696069-1696371	Sequence	YPTS_1520 - hypothetical protein (Protein is coded in complementary strand; from 1696371 to 1696069)