Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1656634
End position: 1656684
Length: 51

DNA sequence
>NC_010634, from 1656634 to 1656684 (51 bp); Yersinia pseudotuberculosis PB1/+ TGAATAGTACTGATTTATGAATAGCACTGACTTATGAATAGCACTGGCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1654692-1656641	Sequence	YPTS_1491 - macrolide transporter ATP-binding /permease