Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1391690
End position: 1391734
Length: 45

DNA sequence
>NC_010634, from 1391690 to 1391734 (45 bp); Yersinia pseudotuberculosis PB1/+ ACATCATTCATAACGTCATCATTCATAACGTCATCATTTATAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1391728-1392798	Sequence	YPTS_1246 galM aldose 1-epimerase (Protein is coded in complementary strand; from 1392798 to 1391728)