Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1380715
End position: 1380777
Length: 63

DNA sequence
>NC_010634, from 1380715 to 1380777 (63 bp); Yersinia pseudotuberculosis PB1/+ AAAAGCAAGTTGCTGAACAACAAAAACAAATCGCTGAACAGCAAAAGCAGGCCGCTGAACAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1380334-1381509	Sequence	YPTS_1235 tolA cell envelope integrity inner membrane protein TolA