Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1297014
End position: 1297055
Length: 42

DNA sequence
>NC_010634, from 1297014 to 1297055 (42 bp); Yersinia pseudotuberculosis PB1/+ TAGTCTGCTTCAACTAATCTGTTTCAACTAATCTGCTTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1297042-1298937	Sequence	YPTS_1154 - penicillin-binding protein 2 (Protein is coded in complementary strand; from 1298937 to 1297042)