Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1277852
End position: 1277905
Length: 54

DNA sequence
>NC_010634, from 1277852 to 1277905 (54 bp); Yersinia pseudotuberculosis PB1/+ GCGGAAAAGACATGTAATACGGAAAATAAATGTAATACGGAAAATAAATGTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1277823-1279811	Sequence	YPTS_1134 - ribokinase-like domain-containing protein