Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1213819
End position: 1213875
Length: 57

DNA sequence
>NC_010634, from 1213819 to 1213875 (57 bp); Yersinia pseudotuberculosis PB1/+ CGCTACCATTAAAATAATACGCTGCCGTGAAAATAATACGCTGCCGTGAAAATAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1213417-1213836	Sequence	YPTS_1071 - MerR family transcriptional regulator