Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1157461
End position: 1157514
Length: 54

DNA sequence
>NC_010634, from 1157461 to 1157514 (54 bp); Yersinia pseudotuberculosis PB1/+ TGTTGTCGCTCACCGCAATGTTGTTGTTTACCGCAATGTTGTCGCTCACCGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1157037-1157600	Sequence	YPTS_1019 - methylated-DNA--protein-cysteine methyltransferase (Protein is coded in complementary strand; from 1157600 to 1157037)