Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1152819
End position: 1152863
Length: 45

DNA sequence
>NC_010634, from 1152819 to 1152863 (45 bp); Yersinia pseudotuberculosis PB1/+ GCTATTGATAAAGGCTCTATTGATCAAAGCACTATTGATCAAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1151059-1152882	Sequence	YPTS_1013 - putative multidrug transporter membrane\ATP-binding components