Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1085043
End position: 1085066
Length: 24

DNA sequence
>NC_010634, from 1085043 to 1085066 (24 bp); Yersinia pseudotuberculosis PB1/+ GCTGTTGCTCTTGCTGATGTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1083806-1087495	Sequence	YPTS_0956 - SMC domain-containing protein (Protein is coded in complementary strand; from 1087495 to 1083806)