Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1032837
End position: 1032890
Length: 54

DNA sequence
>NC_010634, from 1032837 to 1032890 (54 bp); Yersinia pseudotuberculosis PB1/+ TTGATGTGAATTCTAACGTTGATGTAAAACCTAACGTTGACGTAAATCCTAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1032237-1032905	Sequence	YPTS_0915 - methylthioribulose-1-phosphate dehydratase