Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1014508
End position: 1014537
Length: 30

DNA sequence
>NC_010634, from 1014508 to 1014537 (30 bp); Yersinia pseudotuberculosis PB1/+ TGCAGGTTAATGCAGGTTAATGCAGGTTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1014535-1016070	Sequence	YPTS_0897 - EmrB/QacA family drug resistance transporter (Protein is coded in complementary strand; from 1016070 to 1014535)