Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 1012979
End position: 1013029
Length: 51

DNA sequence
>NC_010634, from 1012979 to 1013029 (51 bp); Yersinia pseudotuberculosis PB1/+ TTCATACATTAGCCTTTATCATATGTTAGCCTTTATCATACATTAGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1012547-1012984	Sequence	YPTS_0895 - thioredoxin 2 (Protein is coded in complementary strand; from 1012984 to 1012547)