Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 908166
End position: 908216
Length: 51

DNA sequence
>NC_010634, from 908166 to 908216 (51 bp); Yersinia pseudotuberculosis PB1/+ GGCAGTCTCTCAATAACGACAGTCTCTGAATAATGACGGTCTCTAAATAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 907470-908195	Sequence	YPTS_0804 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase