Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 2591517
End position: 2591567
Length: 51

DNA sequence
>NC_010634, from 2591517 to 2591567 (51 bp); Yersinia pseudotuberculosis PB1/+ GAGGTCTAGCGTGCCAGTAGGTCTAGCGTACCCGTAGGTCTATCGTACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2591540-2592520	Sequence	YPTS_2337 - mandelate racemase/muconate lactonizing protein (Protein is coded in complementary strand; from 2592520 to 2591540)