Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 270249
End position: 270297
Length: 49

DNA sequence
>NC_010634, from 270249 to 270297 (49 bp); Yersinia pseudotuberculosis PB1/+ ATTAACAATTAACAATTAACAATTAACTATTAACTATTAACTATTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 270286-270804	Sequence	YPTS_0248 - hypothetical protein (Protein is coded in complementary strand; from 270804 to 270286)