Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 4425649
End position: 4425696
Length: 48

DNA sequence
>NC_010634, from 4425649 to 4425696 (48 bp); Yersinia pseudotuberculosis PB1/+ ACAATGACGAGCGCCAACAATAACGAGCGCTAACAATTACCAGCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4423166-4425685	Sequence	YPTS_3980 - glycogen/starch/alpha-glucan phosphorylase (Protein is coded in complementary strand; from 4425685 to 4423166)