Sequence retrieval

Genome: Yersinia pseudotuberculosis PB1/+
Start position: 950918
End position: 950962
Length: 45

DNA sequence
>NC_010634, from 950918 to 950962 (45 bp); Yersinia pseudotuberculosis PB1/+ TTATCAAGACATTGTTTATAAAGATACTGTTTATCAAGACAGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 950899-951609	Sequence	YPTS_0843 - twin-argninine leader-binding protein DmsD