Sequence retrieval

Genome: Burkholderia phymatum STM815
Start position: 916749
End position: 916784
Length: 36

DNA sequence
>NC_010622, from 916749 to 916784 (36 bp); Burkholderia phymatum STM815 TCGACGACCGGCTCGACGACCGGCTCGACGACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 916407-919685	Sequence	Bphy_0818 - ribonuclease (Protein is coded in complementary strand; from 919685 to 916407)