Sequence retrieval

Genome: Burkholderia phymatum STM815
Start position: 2496479
End position: 2496514
Length: 36

DNA sequence
>NC_010622, from 2496479 to 2496514 (36 bp); Burkholderia phymatum STM815 TGTGCCGCTTCATCTGCCGCTTCATCTGCCGCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2495918-2496688	Sequence	Bphy_2223 - hypothetical protein (Protein is coded in complementary strand; from 2496688 to 2495918)