Sequence retrieval

Genome: Burkholderia phymatum STM815
Start position: 2091430
End position: 2091459
Length: 30

DNA sequence
>NC_010622, from 2091430 to 2091459 (30 bp); Burkholderia phymatum STM815 TGAGTGTCACTGAGTGTCAGTGAGCGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2091437-2092402	Sequence	Bphy_1831 - hypothetical protein (Protein is coded in complementary strand; from 2092402 to 2091437)