Sequence retrieval

Genome: Burkholderia phymatum STM815
Start position: 1848661
End position: 1848708
Length: 48

DNA sequence
>NC_010622, from 1848661 to 1848708 (48 bp); Burkholderia phymatum STM815 GCTCAATGTGCCGCTCATTGTGCCGCTCATTGTGCCGCTCAATGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1848700-1849758	Sequence	Bphy_1626 - sulfate ABC transporter ATPase (Protein is coded in complementary strand; from 1849758 to 1848700)