Sequence retrieval

Genome: Burkholderia phymatum STM815
Start position: 1382518
End position: 1382571
Length: 54

DNA sequence
>NC_010622, from 1382518 to 1382571 (54 bp); Burkholderia phymatum STM815 CGCAGCGGGCGCAGCGGGCGCAGCGGGCGCAGCGGGCGCAGCGGGCGCAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1382441-1384228	Sequence	Bphy_1232 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 1384228 to 1382441)