Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 952777
End position: 952812
Length: 36

DNA sequence
>NC_010617, from 952777 to 952812 (36 bp); Kocuria rhizophila DC2201 CGCCCCCGCCGTGGCCCCCGCCGAAGCCGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 952686-954704	Sequence	KRH_08730 - hypothetical protein (Protein is coded in complementary strand; from 954704 to 952686)