Sequence retrieval

Genome: Kocuria rhizophila DC2201
Start position: 776451
End position: 776477
Length: 27

DNA sequence
>NC_010617, from 776451 to 776477 (27 bp); Kocuria rhizophila DC2201 CAGGGACACCGGGGACACCAGGGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 776131-777366	Sequence	KRH_07130 - RmuC family protein (Protein is coded in complementary strand; from 777366 to 776131)